Что такое findslide.org?

FindSlide.org - это сайт презентаций, докладов, шаблонов в формате PowerPoint.

Для правообладателей

Обратная связь

Email: Нажмите что бы посмотреть 

Яндекс.Метрика

Презентация на тему Genomes & Genomics

Содержание

Genome, the entire genetic complement of an organismGenomics, research that addresses all or a substantial portion of an organism’s genome Includes physical mapping & sequencing of all or a large part of a genome or chromosome
Genomes & Genomics Genome, the entire genetic complement of an organismGenomics, research that addresses all Why Study Genomes of Different Organisms?To understand the genetics behind diseases How Many Genomes Have Been Sequenced? Completed Draft In ProgressEukaryote 24 129 182Archaea 46 4 27Eubacteria 521 414 402Viral 1703 (NCBI 9/4/07) How Do We Measure a Genome? 1 base=1 nucleotide=1basepair (bp) 1000bases=1kilobase (Kb) 1000kb=1megabase (Mb) 1000mb=1gigabase (Gb) Genome Sizes (haploid)Organism Genome in MbE. coli 4.64Yeast 12Nematode 97Fruit Fly 170Pufferfish 345Human 3200Lungfish 129000 105 106 107 108 109 1010 1011 1012basepairsAmount http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/fig14.html http://www.chromosome18.org/graphics/Slide.gifhttp://uk.encarta.msn.com/media_121636626/Fruit_Fly_Chromosomes.htmlGenomes Are Organized Into ChromosomesHumanFruit Fly Chromosome Number Is Species Specific Diploid Number 2nHuman 46Mouse 40Fruit Fly 8Dog 78Arabidopsis 10Corn 20Yeast 32Crayfish 200 How many genes do we have?Original estimate was between 50 000 to http://www.mun.ca/biology/desmid/brian/BIOL2250/Week_Two/genespac.jpgGene Spacing in Various Species Even the Amount of DNA a Gene Spans Differs Amongst Species Comparative Genomics Yeast 70 human genes are known to repair mutations in yeastNearly all Drosophila nearly all we know of how mutations affect gene function come C. elegans 959 cells in the nervous system 131 of those programmed Mouse known as “mini” humansVery similar physiological systemsShare 90% of their genes What is the rest of the human genome made up of?Regulatory regions Genetic vs. Physical Mapping Genetic mapping based on genetic techniques, maps show the positions of diseases http://www.ornl.gov/TechResources/Human_Genome/graphics/slides/images/98-1455.jpgGenetic Map showing the location of disease genes on human chromosome 4 Human chromosomes stained to show bands of different DNAThese bands are the Fluorescent Labeling of Chromosomeshttp://www.mun.ca/biology/scarr/FISH_chromosome_painting.htm http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=hmg.figgrp.1556Types of Physical MapsFor Chromosome 21 http://freepages.genealogy.rootsweb.com/~patafordgenealogy/images/usmaphyperlinks.jpghttp://socialstudies.ccswebacademy.net/CivicsEconomicsJenkins/images/Map_Outline_US_Outline.jpgThe more markers better the resolution, the more useful the map DNA Sequencing Polyacrylamide gel electrophoresis can resolve ssDNA molecules that differ in length by Automatic Sequencing Machines use fluorescent dyes Fluorescent Dye Dideoxy-sequencing http://www.ornl.gov/TechResources/Human_Genome/graphics/slides/ttseqfacility.htmlDNA Sequencers in Action First Complete Sequence of a Free-Living Organism 1995, the Haemophilus influenzae genome sequencedGenome size=1830 kb 1st genome sequenced using 1st proposed by the DoE 1984 By 1990, the Human Genome Project First Steps of the Human Genome Project1) Construct genetic & physical maps Sequencing Plan of HUGO1) Isolate each human chromosome2) Physical mapping of each Each YAC or BAC is fragmented into smaller 1 to 2 kb Hierarchical Shotgun Approachhttp://www.genome.ou.edu/3653/3653-101705.htmlSeparate Individual Chromosomes http://www.csmc.edu/csri/korenberg/chroma11.htmlChromosome 11 BACs 1999, Celera Genomics, set out to sequence the human genome using a 14.8-billion bp of DNA sequence was generated over 9 monthsThis equaled 5x http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=genomes.figgrp.6211Hierarchical Shotgun ApproachWhole-Genome Shotgun Approach Celera took multiple copies of the genome fragmented them into 1 to What did they learn?1.1% of the genome is spanned by exons24% is Preliminary Functional Analysis of >26 000 genes>12 000 (41%) have no known Diploid Genome Sequence of an Individual HumanOn September 4th, 2007, a team How Do We Differ?Total of 4.1 million DNA variations3.2 million single nucleotide The UCSC Genome Browser The browser takes you from early maps of the genome . . . . . . to a multi-resolution view . . . . . . at the gene cluster level . . . . . . the single gene level . . . . . . the single exon level . . . . . . and at the single base level caggcggactcagtggatctggccagctgtgacttgacaag caggcggactcagtggatctagccagctgtgacttgacaag Other –omicsProteomicsTranscriptomicsMetabolomicsGlycomicsEpigenomicsMetagenomics
Слайды презентации

Слайд 2 Genome, the entire genetic complement of an organism
Genomics,

Genome, the entire genetic complement of an organismGenomics, research that addresses

research that addresses all or a substantial portion of

an organism’s genome
Includes physical mapping & sequencing of all or a large part of a genome or chromosome

Слайд 3 Why Study Genomes of Different Organisms?
To understand the

Why Study Genomes of Different Organisms?To understand the genetics behind diseases

genetics behind diseases (Homo sapien

& Canis familiarus)
To learn more about human pathogens & how to prevent or treat their infections (Clostridium tetani, Bacillus anthacis, & Haemophilus influenzae)
Understand & improve the genetics of commercial organisms (Lactococcus lactis, Oryza sativa, Bos taurus, & Gallus gallus)
To discover the workings of unusual or odd organisms (Bdellovibrio bacteriovorus & Deinococcus radiodurans)
To understand phyolegeny

Слайд 4 How Many Genomes Have Been Sequenced?
Completed Draft In Progress
Eukaryote 24 129 182
Archaea

How Many Genomes Have Been Sequenced? Completed Draft In ProgressEukaryote 24 129 182Archaea 46 4 27Eubacteria 521 414 402Viral 1703 (NCBI 9/4/07)

46 4 27
Eubacteria 521 414 402
Viral 1703
(NCBI 9/4/07)

Слайд 5


How Do We Measure a Genome?

1 base=1

How Do We Measure a Genome? 1 base=1 nucleotide=1basepair (bp) 1000bases=1kilobase (Kb) 1000kb=1megabase (Mb) 1000mb=1gigabase (Gb)

nucleotide=1basepair (bp)
1000bases=1kilobase (Kb)
1000kb=1megabase (Mb)
1000mb=1gigabase (Gb)

Слайд 6 Genome Sizes (haploid)
Organism Genome in Mb
E. coli 4.64
Yeast 12
Nematode 97
Fruit Fly 170
Pufferfish 345
Human 3200
Lungfish 129000

Genome Sizes (haploid)Organism Genome in MbE. coli 4.64Yeast 12Nematode 97Fruit Fly 170Pufferfish 345Human 3200Lungfish 129000

Слайд 7 105 106 107 108 109 1010 1011

105 106 107 108 109 1010 1011 1012basepairsAmount of DNA in a

1012
basepairs
Amount of DNA in a Genome

Does Not Correlate with Complexity

Слайд 8 http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/fig14.html

http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/fig14.html

Слайд 9 http://www.chromosome18.org/graphics/Slide.gif
http://uk.encarta.msn.com/media_121636626/Fruit_Fly_Chromosomes.html
Genomes Are Organized Into Chromosomes
Human
Fruit Fly

http://www.chromosome18.org/graphics/Slide.gifhttp://uk.encarta.msn.com/media_121636626/Fruit_Fly_Chromosomes.htmlGenomes Are Organized Into ChromosomesHumanFruit Fly

Слайд 10 Chromosome Number Is Species Specific
Diploid Number 2n
Human 46
Mouse 40
Fruit Fly 8
Dog 78
Arabidopsis 10
Corn 20
Yeast 32
Crayfish 200

Chromosome Number Is Species Specific Diploid Number 2nHuman 46Mouse 40Fruit Fly 8Dog 78Arabidopsis 10Corn 20Yeast 32Crayfish 200

Слайд 11 How many genes do we have?
Original estimate was

How many genes do we have?Original estimate was between 50 000

between 50 000 to 100 000 genes
We now think

human have ~ 25 000 genes
How does this compare to other organisms?
Mice have ~30 000 genes
Pufferfish have ~35 000 gene
The nematode (C. elegans), has ~19 000
Yeast (S. cerevisiae) there are ~6000 genes
The microbe responsible for tuberculosis has ~4000

Слайд 12 http://www.mun.ca/biology/desmid/brian/BIOL2250/Week_Two/genespac.jpg
Gene Spacing in Various Species

http://www.mun.ca/biology/desmid/brian/BIOL2250/Week_Two/genespac.jpgGene Spacing in Various Species

Слайд 13 Even the Amount of DNA a Gene Spans

Even the Amount of DNA a Gene Spans Differs Amongst Species

Differs Amongst Species

Слайд 14 Comparative Genomics

Comparative Genomics

Слайд 15 Yeast
70 human genes are known to repair

Yeast 70 human genes are known to repair mutations in yeastNearly

mutations in yeast
Nearly all we know about cell cycle

and cancer comes from studies of yeast
Advantages:
fewer genes (6000)
few introns
31% of yeast genes give same products as human homologues

Слайд 16 Drosophila
nearly all we know of how mutations

Drosophila nearly all we know of how mutations affect gene function

affect gene function come from Drosophila studies
We share 50%

of their genes
61% of genes mutated in 289 human diseases are found in fruit flies
68% of genes associated with cancers are found in fruit flies
Knockout mutants
Homeobox genes

Слайд 17 C. elegans
959 cells in the nervous system

C. elegans 959 cells in the nervous system 131 of those

131 of those programmed for apoptosis
apoptosis involved in

several human genetic neurological disorders
Alzheimers
Huntingtons
Parkinsons

Слайд 18 Mouse
known as “mini” humans
Very similar physiological systems
Share

Mouse known as “mini” humansVery similar physiological systemsShare 90% of their genes

90% of their genes

Слайд 19 What is the rest of the human genome

What is the rest of the human genome made up of?Regulatory

made up of?
Regulatory regions of DNA that turn genes

on or off
Repetitive DNA sequences:
Tandem Repetitive Sequences (~10%)
Microsatellite DNA: 2 to 4bp long repeats
Minisatellite DNA: 20bp or longer repeats
Macrosatellite DNA: megabase long repeats
Transposable elements SINEs and LINEs 35%
Retroviral fossils

Слайд 20

Слайд 21 Genetic vs. Physical Mapping

Genetic vs. Physical Mapping

Слайд 22 Genetic mapping based on genetic techniques, maps show

Genetic mapping based on genetic techniques, maps show the positions of

the positions of diseases or traits based on recombination

frequencies
Genetic techniques include cross-breeding experiments or, the examination of family histories (pedigrees)

Physical mapping uses molecular biology techniques to examine DNA molecules directly to construct maps showing the positions of sequence features, including genes
Physical techniques include DNA restriction enzyme analysis & fluorescent tagging of chromosomal regions

Слайд 23 http://www.ornl.gov/TechResources/Human_Genome/graphics/slides/images/98-1455.jpg
Genetic Map showing the location of disease genes

http://www.ornl.gov/TechResources/Human_Genome/graphics/slides/images/98-1455.jpgGenetic Map showing the location of disease genes on human chromosome 4

on human chromosome 4

Слайд 24 Human chromosomes stained to show bands of different

Human chromosomes stained to show bands of different DNAThese bands are

DNA
These bands are the roughest markers for physical mapping

Слайд 25 Fluorescent Labeling of Chromosomes
http://www.mun.ca/biology/scarr/FISH_chromosome_painting.htm

Fluorescent Labeling of Chromosomeshttp://www.mun.ca/biology/scarr/FISH_chromosome_painting.htm

Слайд 26 http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=hmg.figgrp.1556
Types of Physical Maps
For Chromosome 21

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=hmg.figgrp.1556Types of Physical MapsFor Chromosome 21

Слайд 27 http://freepages.genealogy.rootsweb.com/~patafordgenealogy/images/usmaphyperlinks.jpg
http://socialstudies.ccswebacademy.net/CivicsEconomicsJenkins/images/Map_Outline_US_Outline.jpg
The more markers better the resolution, the more

http://freepages.genealogy.rootsweb.com/~patafordgenealogy/images/usmaphyperlinks.jpghttp://socialstudies.ccswebacademy.net/CivicsEconomicsJenkins/images/Map_Outline_US_Outline.jpgThe more markers better the resolution, the more useful the map

useful the map

Слайд 28 DNA Sequencing

DNA Sequencing

Слайд 29 Polyacrylamide gel electrophoresis can resolve ssDNA molecules that

Polyacrylamide gel electrophoresis can resolve ssDNA molecules that differ in length

differ in length by just one nucleotide
A banding pattern

is produced after separation of ssDNA molecules by denaturing polyacrylamide gel electrophoresis

Слайд 30

Слайд 31 Automatic Sequencing Machines use fluorescent dyes

Automatic Sequencing Machines use fluorescent dyes

Слайд 32 Fluorescent Dye Dideoxy-sequencing

Fluorescent Dye Dideoxy-sequencing

Слайд 33 http://www.ornl.gov/TechResources/Human_Genome/graphics/slides/ttseqfacility.html
DNA Sequencers in Action

http://www.ornl.gov/TechResources/Human_Genome/graphics/slides/ttseqfacility.htmlDNA Sequencers in Action

Слайд 34 First Complete Sequence of a Free-Living Organism

First Complete Sequence of a Free-Living Organism

Слайд 35 1995, the Haemophilus influenzae genome sequenced
Genome size=1830 kb

1995, the Haemophilus influenzae genome sequencedGenome size=1830 kb 1st genome sequenced


1st genome sequenced using the shotgun method
28,643 sequencing experiments

totaling 11,631,485 bp
This equaled 6x the length of the H. influenzae genome
Sequence assembly 30 hrs on a computer with 512 Mb of RAM
Resulted in 140 lengthy contiguous sequences
Each sequence contig represented, non-overlapping portion of the genome

Слайд 36

Слайд 37

Слайд 38

Слайд 39 1st proposed by the DoE 1984
By 1990,

1st proposed by the DoE 1984 By 1990, the Human Genome

the Human Genome Project was launched
The Human Genome

Organization (HUGO) was founded to provide a forum for international coordination of genomic research
The program was proposed to include:
The creation of genetic & physical maps to be used in the generation of a complete genome sequence

Human Genome Project

Слайд 40 First Steps of the Human Genome Project

1) Construct

First Steps of the Human Genome Project1) Construct genetic & physical

genetic & physical maps of the haploid human &

mouse genomes
These would provide key tools for identification of disease genes and anchoring points for genomic sequence
2) Sequence the yeast and worm genomes, as well as targeted regions of mammalian genomes

Слайд 41 Sequencing Plan of HUGO
1) Isolate each human chromosome
2)

Sequencing Plan of HUGO1) Isolate each human chromosome2) Physical mapping of

Physical mapping of each chromosome
The banding pattern of visible

through staining
Location of known genes already mapped
Location of restriction enzyme sites
Chromosome fragmented into large pieces of DNA and inserted into BAC or YAC libraries
Fragments overlap such that they can be ordered into a rough assembly of the chromosome

DNA from 5 humans
2 males, 3 females
2 caucasians, one each of asian, african, hispanic

Слайд 42 Each YAC or BAC is fragmented into smaller

Each YAC or BAC is fragmented into smaller 1 to 2

1 to 2 kb pieces of DNA which are

sequenced
Each of these fragments slightly overlaps with each other
A computer takes the DNA sequences & looks for regions of overlap these are connected to form a sequence contig for the entire BAC or YAC
The sequence of all the YACs or BACs are assembled through the same process to give the sequence of the chromosome
This is repeated for all 22 chromosomes plus the X & Y

Слайд 43 Hierarchical Shotgun Approach
http://www.genome.ou.edu/3653/3653-101705.html
Separate Individual Chromosomes

Hierarchical Shotgun Approachhttp://www.genome.ou.edu/3653/3653-101705.htmlSeparate Individual Chromosomes

Слайд 44

Слайд 45 http://www.csmc.edu/csri/korenberg/chroma11.html
Chromosome 11 BACs

http://www.csmc.edu/csri/korenberg/chroma11.htmlChromosome 11 BACs

Слайд 46 1999, Celera Genomics, set out to sequence the

1999, Celera Genomics, set out to sequence the human genome using

human genome using a whole-genome shotgun method - more

riskier - goal to patent some seq.
There would be no isolation of individual chromosomes & no subcloning into BACs or YACs
They skipped straight to the 1 to 2 kb fragments
The $300 million Celera effort was intended to proceed at a faster pace and at a fraction of the cost of the roughly $3 billion HUGO project.

Dr. Craig Venter (founder) Celera Genomics

Human Genome Whole-Genome Shotgun Method

Слайд 47
14.8-billion bp of DNA sequence was generated over

14.8-billion bp of DNA sequence was generated over 9 monthsThis equaled

9 months
This equaled 5x the human genome
Resulting sequence contigs

spanned >99% of the genome
In March 2000, President Clinton announced that the genome sequences could not be patented, and should be made freely available to all researchers. The statement sent Celera's stock plummeting.
The competition proved to be very good for the project, spurring the public groups to modify their strategy in order to accelerate progress.
In February 2001 Celera Genomics published their draft of the human genome in the journal Science
The same month HUGO published its draft of the human genome in the journal Nature
The rivals initially agreed to pool their data, but the agreement fell apart when Celera refused to deposit its data in the unrestricted public database GeneBank.

Слайд 48 http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=genomes.figgrp.6211
Hierarchical Shotgun Approach
Whole-Genome Shotgun Approach

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=genomes.figgrp.6211Hierarchical Shotgun ApproachWhole-Genome Shotgun Approach

Слайд 49 Celera took multiple copies of the genome fragmented

Celera took multiple copies of the genome fragmented them into 1

them into 1 to 2kb fragments which where sequenced

without concern for what chromosome they belonged to

Слайд 50
What did they learn?
1.1% of the genome is

What did they learn?1.1% of the genome is spanned by exons24%

spanned by exons
24% is in introns
75% of the genome

is intergenic DNA
A random pair of human haploid genomes differs on average at a rate of 1 bp per 1250 bp

Слайд 51 Preliminary Functional Analysis of >26 000 genes
>12 000

Preliminary Functional Analysis of >26 000 genes>12 000 (41%) have no

(41%) have no known function
S. Barnum, 2005 Biotechnology, An

Introduction. Brookes/Cole

Слайд 52 Diploid Genome Sequence of an Individual Human
On September

Diploid Genome Sequence of an Individual HumanOn September 4th, 2007, a

4th, 2007, a team led by Craig Venter, published

his (ovn) complete DNA sequence, unveiling the six-billion-letter genome of a single individual for the first time.
44% of known genes had one or more alterations
>0.5% variation between two haploid genomes



Слайд 53 How Do We Differ?
Total of 4.1 million DNA

How Do We Differ?Total of 4.1 million DNA variations3.2 million single

variations
3.2 million single nucleotide changes
53,800 block substitutions (2 to

206bp)
292,000 heterozygous insertion/deletions (1 to 571bp)
559,000 homozygous insertion/deletions (1 to 82,711bp)
90 inversions
Numerous duplications & copy number variations

Слайд 54 The UCSC Genome Browser

The UCSC Genome Browser

Слайд 55 The browser takes you from early maps of

The browser takes you from early maps of the genome . . .

the genome . . .

Слайд 56 . . . to a multi-resolution view .

. . . to a multi-resolution view . . .

Слайд 57 . . . at the gene cluster level

. . . at the gene cluster level . . .

. . .

Слайд 58 . . . the single gene level .

. . . the single gene level . . .

. .

Слайд 59 . . . the single exon level .

. . . the single exon level . . .

Слайд 60 . . . and at the single base

. . . and at the single base level caggcggactcagtggatctggccagctgtgacttgacaag caggcggactcagtggatctagccagctgtgacttgacaag

level
caggcggactcagtggatctggccagctgtgacttgacaag
caggcggactcagtggatctagccagctgtgacttgacaag

  • Имя файла: genomes-amp-genomics.pptx
  • Количество просмотров: 214
  • Количество скачиваний: 0
- Предыдущая BOSTON
Следующая - ЧС Тащусь по своей группеПрезентацияНа тему:Айнур, спасибо, что ты есть Выполнила: Коспанова А. Проверила: Смагулова А.Астана-Семей2012

Похожие презентации

Английские буквы и звуки Английские буквы и звуки 217
Present Perfect Progressive Present Perfect Progressive 290
Тренажер по английскому языку Тренажер по английскому языку 148
Развитие связной речи Развитие связной речи 114
Презентация для учащихся начальной школы на тему Юрий Гагарин Презентация для учащихся начальной школы на тему Юрий Гагарин 151
Подготовка к уроку в соответствии с требованиями ФГОС Подготовка к уроку в соответствии с требованиями ФГОС 153
University of Bristol University of Bristol 222
My Travels My Travels 145
Презентация по английскому языку Путешествуем с английским Презентация по английскому языку Путешествуем с английским 130
Dead Sea in Danger Dead Sea in Danger 107
Великая Отечественная Война Великая Отечественная Война 149
The Beatles The Beatles 142
Jazz Jazz 118
Презентация по английскому языку Фонетическая зарядка Презентация по английскому языку Фонетическая зарядка 165
Презентация по теме: Most Famous Landmarks in the World Презентация по теме: Most Famous Landmarks in the World 166
Презентация по английскому языку на тему Car characteristics Презентация по английскому языку на тему Car characteristics 151
Соединённое королевство Великобритании и Северной Ирландии Соединённое королевство Великобритании и Северной Ирландии 155
Animal World of Australia Animal World of Australia 151
Презентация к докладу научной конференции Презентация к докладу научной конференции 159
Презентация по английскому языку на тему Festivals (8 класс) Презентация по английскому языку на тему Festivals (8 класс) 145
Презентация по татарскому языку на тему: Ф.Яруллинның “Әхмәт нигә елады?” хикәясе (рассказ Ф.Яруллина Зачем плачет Ахмет?) Презентация по татарскому языку на тему: Ф.Яруллинның “Әхмәт нигә елады?” хикәясе (рассказ Ф.Яруллина Зачем плачет Ахмет?) 206
Презентация по английскому языку Артикль Презентация по английскому языку Артикль 177
Ajectives (5 кл) Ajectives (5 кл) 147
Презентация по английскому языку Прошедшие времена английского языка Презентация по английскому языку Прошедшие времена английского языка 149
Презентация по английскому языку. Презентация по английскому языку. 159
Презентация по английскому языку для 4 класса для развития навыков употребления was/were. Презентация по английскому языку для 4 класса для развития навыков употребления was/were. 277
Презентация по английскому языку на темуІсторія англійської мови: від зародження до наших днів Презентация по английскому языку на темуІсторія англійської мови: від зародження до наших днів 132
Презентация: British Cars Презентация: British Cars 156
Question words spin easy Question words spin easy 109
Презентация к уроку немецкого языка Мы празднуем день рождения Презентация к уроку немецкого языка Мы празднуем день рождения 200