Что такое findslide.org?

FindSlide.org - это сайт презентаций, докладов, шаблонов в формате PowerPoint.


Для правообладателей

Обратная связь

Email: Нажмите что бы посмотреть 

Яндекс.Метрика

Презентация на тему Forensic DNA Analysis

Содержание

Forensics, pertaining to the courts either criminal or civilForensics DNA analysis is the use of DNA evidenceUsed in: paternity suites victim identification identifying suspects
Forensic DNA Analysis Forensics, pertaining to the courts either criminal or civilForensics DNA analysis is Originally identification was limited to:Physical attributes such as; ethnicity, gender, height, weight, Even though two unrelated humans differ in their DNA only by 0.1 Restriction Fragment Length Polymorphism (RFLP)Detects a single basepair change in DNAMust occur http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htmRFLP DNA FingerprintingFirst described in 1985 by Alec Jeffreys as a method for During the late 80s/early 90s US courts questioned the validity of DNA What creates this unique pattern?Satellite DNA: repetitive DNA sequence.	Macrosatellite: core sequence 100 Repeats of Satellite DNARepeat units vary in length from 2bp to long http://www.usask.ca/biology/rank/316/genomics/genomics.htmOne Mechanism of VNTR Creation Southern blotting can be used to visualize the variationProbes specific to the http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm http://www.mun.ca/biology/scarr/DNA_fingerprinting.htmMulti-loci DNA Fingerprint Multi-locus analysis of Dolly used to prove she was a clone1 –12 http://www.genelex.com/paternitytesting/paternityslide2.htmlSingle-Locus VNTRSingle-locus mini/microsatellite VNTRs generates at most two bandsThough not as unique Skeletal remains exhumed from a site in Brazil in 1985 that were PCR amplification of VNTRPCR is particularly useful in forensic analysis as it Short Tandem Repeats (STR)Are a variation on VNTRs, but use the smallest STRs are isolated using PCRPrimers have been developed to allow amplification of Following the PCR reaction, internal DNA length standards are added to the http://www.biology.arizona.edu/human_bio/activities/blackett2/str_analysis.htmlAnalysis of 3 STRs, D3S1358, vWA, & FGAReference standards with the known Example of a DNA profile using the 13 CODIS STRThe odds of CODIS (Combined DNA Index System)In 1997, the FBI announced the selection of http://www.cstl.nist.gov/div831/strbase/images/codis.jpg Newer Typing TechniquesMiniSTR uses shorter PCR primers giving shorter pieces of DNA
Слайды презентации

Слайд 2 Forensics, pertaining to the courts either criminal or

Forensics, pertaining to the courts either criminal or civilForensics DNA analysis

civil
Forensics DNA analysis is the use of DNA evidence
Used

in:
paternity suites
victim identification
identifying suspects

Слайд 3 Originally identification was limited to:
Physical attributes such as;

Originally identification was limited to:Physical attributes such as; ethnicity, gender, height,

ethnicity, gender, height, weight, hair color, etc.
Friction-ridge identification or

fingerprinting
Blood-antigen & serum proteins, ABO blood groups

Слайд 4 Even though two unrelated humans differ in their

Even though two unrelated humans differ in their DNA only by

DNA only by 0.1 to 0.2% there are still

up to 6 million basepair differences
It is these differences that are used to create a unique DNA “fingerprint” also known as DNA profile

Слайд 5 Restriction Fragment Length Polymorphism (RFLP)
Detects a single basepair

Restriction Fragment Length Polymorphism (RFLP)Detects a single basepair change in DNAMust

change in DNA
Must occur within a restriction enzyme cleavage

sequence to be visible
Often used in disease screening such as in the detection of sickle cell anemia
DNA fragments are often visualized by Southern Blot

Слайд 6 http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm
RFLP

http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htmRFLP

Слайд 8 DNA Fingerprinting
First described in 1985 by Alec Jeffreys

DNA FingerprintingFirst described in 1985 by Alec Jeffreys as a method

as a method for identifying individuals by their unique

pattern of DNA banding
First use of DNA fingerprinting was in a 1985 immigration case in the UK. It identified a child as being the offspring of a British citizen
It was then used to rule out a suspect in a rape/murder case in England in 1986

Слайд 9 During the late 80s/early 90s US courts questioned

During the late 80s/early 90s US courts questioned the validity of

the validity of DNA profiling
The debates centered on evidence

collection procedures, training of technicians, & the statistics used to establish a match
By the mid 1990s DNA profiling was shown to be scientifically valid and DNA evidence became admissible

Слайд 10 What creates this unique pattern?
Satellite DNA: repetitive DNA

What creates this unique pattern?Satellite DNA: repetitive DNA sequence.	Macrosatellite: core sequence

sequence.
Macrosatellite: core sequence 100 to 6500bp
Minisatellite: core sequence of

10-20bp repeated multiple times
Microsatellite: small arrays of tandem repeats of 2 to 4bp in length
(AT)n account for 0.3% of the human genome
(CATG)n accounts for 0.5% of the human genome

Слайд 11 Repeats of Satellite DNA
Repeat units vary in length

Repeats of Satellite DNARepeat units vary in length from 2bp to

from 2bp to long stretches of 6000bp or more
These

repeat units are lined up head to tail and compose satellite DNA and are interspersed throughout the genome
The number of units varies person to person
Thus these sequences are called VNTRs (variable number of tandem repeats)
A VNTR is a locus that is hypervariable due to a large number of alleles each characterized by a different number of repeat units

Слайд 12 http://www.usask.ca/biology/rank/316/genomics/genomics.htm
One Mechanism of VNTR Creation

http://www.usask.ca/biology/rank/316/genomics/genomics.htmOne Mechanism of VNTR Creation

Слайд 13 Southern blotting can be used to visualize the

Southern blotting can be used to visualize the variationProbes specific to

variation
Probes specific to the repeat unit are hybridized to

DNA cut with a restriction enzyme that cuts just outside the VNTR
This allows for the difference in VNTR length to be detected
Two common probes are known are:
33.6 (AGGGCTGGAGG)18
31.5 (AGAGGTGGGCAGGTGG)29
These are multi-locus minisatellite probes and show about 17 different DNA bands for each individual

Слайд 14 http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm

http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm

Слайд 15 http://www.mun.ca/biology/scarr/DNA_fingerprinting.htm
Multi-loci DNA Fingerprint

http://www.mun.ca/biology/scarr/DNA_fingerprinting.htmMulti-loci DNA Fingerprint

Слайд 16 Multi-locus analysis of Dolly used to prove she

Multi-locus analysis of Dolly used to prove she was a clone1

was a clone
1 –12 are control sheep
U is original

udder cells
C is cells from culture
D is Dolly blood cells

Слайд 17 http://www.genelex.com/paternitytesting/paternityslide2.html
Single-Locus VNTR
Single-locus mini/microsatellite VNTRs generates at most two

http://www.genelex.com/paternitytesting/paternityslide2.htmlSingle-Locus VNTRSingle-locus mini/microsatellite VNTRs generates at most two bandsThough not as

bands
Though not as unique as multi-locus VNTRs they are

simple to use
Multiple single-locus VNTRs are used to give a DNA fingerprint

Слайд 18 Skeletal remains exhumed from a site in Brazil

Skeletal remains exhumed from a site in Brazil in 1985 that

in 1985 that were thought to be those of

the Nazi, Josef Mengele
The profile of DNA extracted from a femur (F) was compared with those of his son (R) and wife (I) at 10 different loci, & found to be fully compatible with paternity of Mengele’s son

Actin Mfd49


Слайд 19 PCR amplification of VNTR
PCR is particularly useful in

PCR amplification of VNTRPCR is particularly useful in forensic analysis as

forensic analysis as it allows minute amounts of DNA

to be analyzed
DNA can be obtained from blood stains, semen, saliva, or hair roots
Instead of digesting the DNA PCR is used to amplify the VNTRs and the products are run on a gel and visualized by staining
This process requires primers that anneal just outside the VNTR

Слайд 22 Short Tandem Repeats (STR)
Are a variation on VNTRs,

Short Tandem Repeats (STR)Are a variation on VNTRs, but use the

but use the smallest repeats units often only 2

to 4 bp in length

aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatggagt
tattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacgaa
ctaacgatagatagatagatagatagatagatagatagatagatagatagatagacagat
tgatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatttg

13 core loci of tetrameric repeats are tested together to make a DNA profile
The sequence above is locus D7S280 which is located on chromosome 7

Слайд 23 STRs are isolated using PCR
Primers have been developed

STRs are isolated using PCRPrimers have been developed to allow amplification

to allow amplification of multiple STR loci in a

single reaction mixture
Each primer set has been optimized such that its product, no matter the number of STRs, is not the same size as any of the other products
Each primer set has unique fluorescent molecules covalently linked to them so that they may be visualized immediately by a computer

Слайд 24 Following the PCR reaction, internal DNA length standards

Following the PCR reaction, internal DNA length standards are added to

are added to the reaction mixture
The DNAs are separated

by length in a capillary gel electrophoresis machine
As DNA peaks elute from the gel they are detected with laser activation
The results are then graphed by a computer which compares them to a standard

Слайд 25 http://www.biology.arizona.edu/human_bio/activities/blackett2/str_analysis.html
Analysis of 3 STRs, D3S1358, vWA, & FGA
Reference

http://www.biology.arizona.edu/human_bio/activities/blackett2/str_analysis.htmlAnalysis of 3 STRs, D3S1358, vWA, & FGAReference standards with the

standards with the known alleles for each STR locus



Profile of test subject

Genotype is 15, 15 @ D3S1358, 14, 16 @ vWA, & 24, 25 @ FGA


Слайд 26
Example of a DNA profile using the 13

Example of a DNA profile using the 13 CODIS STRThe odds

CODIS STR
The odds of another person having this profile

1 in 7.7 x 1015

Слайд 27 CODIS (Combined DNA Index System)
In 1997, the FBI

CODIS (Combined DNA Index System)In 1997, the FBI announced the selection

announced the selection of 13 STR loci to constitute

the core of the United States national database, CODIS
All forensic laboratories that use the CODIS system can contribute to the national database
The STRs alleles are easily genotyped using commercial kits
All data from these analyses are digital thus easily placed in the database

Слайд 28 http://www.cstl.nist.gov/div831/strbase/images/codis.jpg

http://www.cstl.nist.gov/div831/strbase/images/codis.jpg

  • Имя файла: forensic-dna-analysis.pptx
  • Количество просмотров: 205
  • Количество скачиваний: 0