Презентация на тему Forensic DNA Analysis

civil
Forensics DNA analysis is the use of DNA evidence
Used

in:
paternity suites
victim identification
identifying suspects

ethnicity, gender, height, weight, hair color, etc.
Friction-ridge identification or

fingerprinting
Blood-antigen & serum proteins, ABO blood groups

DNA only by 0.1 to 0.2% there are still

up to 6 million basepair differences
It is these differences that are used to create a unique DNA “fingerprint” also known as DNA profile

change in DNA
Must occur within a restriction enzyme cleavage

sequence to be visible
Often used in disease screening such as in the detection of sickle cell anemia
DNA fragments are often visualized by Southern Blot

as a method for identifying individuals by their unique

pattern of DNA banding
First use of DNA fingerprinting was in a 1985 immigration case in the UK. It identified a child as being the offspring of a British citizen
It was then used to rule out a suspect in a rape/murder case in England in 1986

the validity of DNA profiling
The debates centered on evidence

collection procedures, training of technicians, & the statistics used to establish a match
By the mid 1990s DNA profiling was shown to be scientifically valid and DNA evidence became admissible

sequence.
Macrosatellite: core sequence 100 to 6500bp
Minisatellite: core sequence of

10-20bp repeated multiple times
Microsatellite: small arrays of tandem repeats of 2 to 4bp in length
(AT)n account for 0.3% of the human genome
(CATG)n accounts for 0.5% of the human genome

from 2bp to long stretches of 6000bp or more
These

repeat units are lined up head to tail and compose satellite DNA and are interspersed throughout the genome
The number of units varies person to person
Thus these sequences are called VNTRs (variable number of tandem repeats)
A VNTR is a locus that is hypervariable due to a large number of alleles each characterized by a different number of repeat units

variation
Probes specific to the repeat unit are hybridized to

DNA cut with a restriction enzyme that cuts just outside the VNTR
This allows for the difference in VNTR length to be detected
Two common probes are known are:
33.6 (AGGGCTGGAGG)18
31.5 (AGAGGTGGGCAGGTGG)29
These are multi-locus minisatellite probes and show about 17 different DNA bands for each individual

was a clone
1 –12 are control sheep
U is original

udder cells
C is cells from culture
D is Dolly blood cells

bands
Though not as unique as multi-locus VNTRs they are

simple to use
Multiple single-locus VNTRs are used to give a DNA fingerprint

in 1985 that were thought to be those of

the Nazi, Josef Mengele
The profile of DNA extracted from a femur (F) was compared with those of his son (R) and wife (I) at 10 different loci, & found to be fully compatible with paternity of Mengele’s son

Actin Mfd49

forensic analysis as it allows minute amounts of DNA

to be analyzed
DNA can be obtained from blood stains, semen, saliva, or hair roots
Instead of digesting the DNA PCR is used to amplify the VNTRs and the products are run on a gel and visualized by staining
This process requires primers that anneal just outside the VNTR

but use the smallest repeats units often only 2

to 4 bp in length

aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatggagt
tattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacgaa
ctaacgatagatagatagatagatagatagatagatagatagatagatagatagacagat
tgatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatttg

13 core loci of tetrameric repeats are tested together to make a DNA profile
The sequence above is locus D7S280 which is located on chromosome 7

to allow amplification of multiple STR loci in a

single reaction mixture
Each primer set has been optimized such that its product, no matter the number of STRs, is not the same size as any of the other products
Each primer set has unique fluorescent molecules covalently linked to them so that they may be visualized immediately by a computer

are added to the reaction mixture
The DNAs are separated

by length in a capillary gel electrophoresis machine
As DNA peaks elute from the gel they are detected with laser activation
The results are then graphed by a computer which compares them to a standard

standards with the known alleles for each STR locus

Profile of test subject

Genotype is 15, 15 @ D3S1358, 14, 16 @ vWA, & 24, 25 @ FGA

CODIS STR
The odds of another person having this profile

1 in 7.7 x 1015

announced the selection of 13 STR loci to constitute

the core of the United States national database, CODIS
All forensic laboratories that use the CODIS system can contribute to the national database
The STRs alleles are easily genotyped using commercial kits
All data from these analyses are digital thus easily placed in the database